| Primary Identifier | MGI:6402258 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Aco2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTTTTCCCTCTCACATGTG and AGTGCCATGGAAAGACTGAC, which resulted in a 418 bp deletion beginning at Chromosome 15 position 81,895,108 bp and ending after 81,895,525 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000127355 (exon 3) and 159 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 58 and early truncation 1 amino acids later. |