| Primary Identifier | MGI:6399883 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gm15551 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at Czech centre for Phenogenomics by injecting CAS9 Protein and 2 guide sequences CCTTACAGGGTTTCGCCTCGGTT, TTGCCTTGGGGGAGACGGGCAGG, which resulted in a Exon Deletion. Sanger sequencing verified a 1113 bp deletion including exon 1 of Gm15551 (3:126462197-126463309, GRCm38). |
