| Primary Identifier | MGI:6393531 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ldhal6b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAAAGAGCGCAGAGACTATT and TCTCAAGATGCTTGTAGCCC, which resulted in a 1112 bp deletion beginning at Chromosome 17 position 5,417,539 bp and ending after 5,418,650 bp (GRCm38/mm10). This mutation deletes 1112 bp of ENSMUSE00001326799 (exon 1) and is predicted to cause a change of amino acid sequence after residue 2 and early truncation 7 amino acids later. |
