|  Help  |  About  |  Contact Us

Allele : Cchcr1<em1Aoka> coiled-coil alpha-helical rod protein 1; endonuclease-mediated mutation 1, Akira Oka

Primary Identifier  MGI:6394064 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Cchcr1
Strain of Origin  C57BL/6NJcl Is Recombinase  false
Is Wild Type  false
molecularNote  Arginine codon 591 (CGT) was targeted for change to a tryptophan codon (TGG)(p.R591W) with sgRNAs (targeting GCTGTGTCAGCTCCTGACGGAGG and GGAAGCTGCCAGCCTCCGTCAGG) and an ssODN template (CAGCAGTTGGAGGCAGCACGTCGGGGCCAGCAGGAGAGCACGGAGGAAGCTGCCAGCCTCtGgCAGGAGCTGACACAGCAGCAGGAAATCTACGGGCAAGGTGTGGGGGCGTGGCGGTGTGTG) using CRISPR/CAS9 technology. This mutation mimics the human p.R587W variant associated with susceptibility to alopecia areata.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Alopecic Cchcr1,
  • Alopecic Cchcr1,
  • Cchcr1<p.Arg587Trp>,
  • Cchcr1<p.Arg587Trp>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele