| Primary Identifier | MGI:6400536 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rbm45 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAATATACAGACATGCAAA and ACTTGCTTACAACTACCAAC, which resulted in a 763 bp deletion beginning at Chromosome 2 position 76,378,345 bp and ending after 76,379,107 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000358265, ENSMUSE00000388560, and ENSMUSE00000345417 (exons 6, 7, and 8) and 294 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 286 and early truncation 5 amino acids later. |
