| Primary Identifier | MGI:6406445 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Clec2g |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTCTGTGGTCTGGACAGTTC and TGTGTCGTGGCTATGAGAGA, which resulted in a 1135 bp deletion beginning at Chromosome 6 position 128,980,911 bp and ending after 128,982,045 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000967171 and ENSMUSE00001067493 (exons 5 and 6) and 849 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 127 and early truncation 12 amino acids later. There is a 9 base pair insertion (ACAATGCAC) at the deletion site. |
