|  Help  |  About  |  Contact Us

Allele : Clec2g<em1(IMPC)J> C-type lectin domain family 2, member g; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6406445 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Clec2g
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTCTGTGGTCTGGACAGTTC and TGTGTCGTGGCTATGAGAGA, which resulted in a 1135 bp deletion beginning at Chromosome 6 position 128,980,911 bp and ending after 128,982,045 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000967171 and ENSMUSE00001067493 (exons 5 and 6) and 849 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 127 and early truncation 12 amino acids later. There is a 9 base pair insertion (ACAATGCAC) at the deletion site.
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele