| Primary Identifier | MGI:6414761 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gid8 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAGGATGCCAGAGCAACAG and GCGCTGCTCTTCCTCTCACA, which resulted in a 2882 bp deletion beginning at Chromosome 2 position 180,714,342 bp and ending after 180,717,223 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000170682 and ENSMUSE00000170684 (exons 2 and 3) and 2487 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 39 and early truncation 3 amino acids later. |
