| Primary Identifier | MGI:6414769 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Jakmip3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTCCGAGGATACTGCACAG and TTCCCCAGAGATACCCACCA, which resulted in a 711 bp deletion beginning at Chromosome 7 position 138,989,077 bp and ending after 138,989,787 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000452940 (exon 2) and 468 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. |
