|  Help  |  About  |  Contact Us

Allele : Cmtm4<em1Wlh> CKLF-like MARVEL transmembrane domain containing 4; endonuclease-mediated mutation1, WenLing Han

Primary Identifier  MGI:6457028 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cmtm4
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 1 was targeted with gRNAs (AGCGCGCCGCGCAGGTAGTC and GAGGAGCTGGACGGCTTCGA) using CRISPR/Cas9 technology, resulting in a 179 bp deletion that includes the ATG translation start codon.
  • mutations:
  • Deletion
  • synonyms:
  • Cmtm4 KO,
  • Cmtm4 KO
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele