| Primary Identifier | MGI:6467245 | Allele Type | Endonuclease-mediated |
| Gene | Rorc | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | CRISPR/cas9 genome editing is used to introduce twin-strep (TS) tag sequence into the last exon of the variant coding region (immediately before the stop codon.TS tag encodes two tandem streptavidin-binding peptides (upper case) that are preceded and separated by linker (lower case) sequences: [Last Rorc exon: CTGCCACCCAAAGGAAAACTCCGGAGCCTGTGCAGCCAACATGTGGAAAAGCTGCAGATCTTCCAGCACCTCCACCCCATCGTGGTCCAAGCCGCCTTCCCTCCACTCTATAAGGAACTCTTCAGCACTGATGTTGAATCCCCTGAGGGGCTGTCAAAG] ggaggcggatcgggaggcggatcgggcggatcggca TGGTCGCATCCGCAGTTTGAAAAA ggaggcggatcgggaggcggatcgggcgga TCCGCT TGGTCGCATCCGCAGTTTGAAAAG [TGA stop]. |
