| Primary Identifier | MGI:6468335 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Bicral |
| Inheritance Mode | Not Specified | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCTTGTGACTGACAGGAGA and ATTTTTAGCTCACCAAGCAA, which resulted in a 532 bp deletion beginning at Chromosome 17 position 46,829,784 bp and ending after 46,830,315 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000424961, ENSMUSE00000424956 (exons 2,3) and 414 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 14 and early truncation 10 amino acids later. |
