|  Help  |  About  |  Contact Us

Allele : Rnf183<em1Kaim> ring finger protein 183; endonuclease-mediated mutation 1, Kazunori Imaizumi

Primary Identifier  MGI:6488086 Allele Type  Endonuclease-mediated
Attribute String  Reporter Gene  Rnf183
Strain of Origin  (C57BL/6 x DBA/2)F1 Is Recombinase  false
Is Wild Type  false
molecularNote  The GFP fluorescent marker gene and linker sequence was inserted upstream of the coding region in exon 3 using a donor plasmid, a crRNA (CAGAGGAUGAGCGAACCACAGUUUUAGAGCUAUGCUGUUUUG) and a tracrRNA (AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU) with CRISPR/Cas9 technology.
  • mutations:
  • Insertion
  • synonyms:
  • RNF183-GFP,
  • RNF183-GFP
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele