| Primary Identifier | MGI:6511988 | Allele Type | Endonuclease-mediated |
| Gene | Nr3c1 | Strain of Origin | FVB/NJ |
| Is Recombinase | false | Is Wild Type | false |
| description | This allele was generated from Nr3c1tm3Gsc. |
| molecularNote | Using an sgRNA (targeting GCTATGCTTTGCTCCTGA) and ssODN template (G GCATTTGCCCTGGGTTGGAGATCATACAGACAAGCAAGTGGAAACCTGCTATGCTTTGCTCCTGATCTGATTATTAATGAGTAAGTTACATGGCCTTAACCCTCCACAAAGAACTA) with CRISPR/Cas9 technology, isoleucine codon 643 (ATT) in exon 6 was changed to alanine (GCT) (p.I643A). Targeting was performed in Nr3c1tm3Gsc heterozygote zygotes to produce mice with either p.I643A only (Nr3c1em1Clib) or p.I643A plus p.A474T in cis (this allele). Peptide coordinates are in reference to canonical sequence SW:P06537-1 with the full complement of polyQ at the N-terminal end. |
