| Primary Identifier | MGI:6512073 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tmem106b |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Exon 3 (containing the start codon) was targeted with a gRNA (targeting AGTGAAGTGCACAACGAAGACGG) using CRISPR/Cas9 technology, resulting in a 2 bp deletion (AA). Immunoblots of brain and spinal cord lysates confirm the absence of peptide expression from this allele. |
