|  Help  |  About  |  Contact Us

Allele : Ppil1<em5Jgg> peptidylprolyl isomerase (cyclophilin)-like 1; endonuclease-mediated mutation 5, Joseph Gleeson

Primary Identifier  MGI:6509463 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Ppil1
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Using a crRNA (targeting TGAAGTCCTTGATGATCCTG), tracrRNA and an ssODN template (GTCATTGTCCTGGAGCTATACTGGAAGCATGCGCCCAAGACCTGCAAGAACTTCGCGGAGCTGGCTCGGCGGGGCTACTACAATGGCACCAAGTTTCACCGGATCATCAAGGACTTCATGATCCAAGGCGGCGACCCGACAGGCACAGGTACACTTAAGCCACCATTGGGGAGGAACTGGGTGGTAAGGCAGCCACAGCT) with CRISPR/Cas9 technology, an AG-to-GC mutation (CT-to-GC on forward strand) was engineered to change arginine codon 55 (AGG) to an alanine codon (GCG) (p.R55A). This mutation mimics a human mutation found in pontocerebellar hypoplasia plus microcephaly (PCHM) patients.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Ppil1<R55A>,
  • Ppil1<R55A>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele