|  Help  |  About  |  Contact Us

Allele : Ppil1<em2Jgg> peptidylprolyl isomerase (cyclophilin)-like 1; endonuclease-mediated mutation 2, Joseph Gleeson

Primary Identifier  MGI:6509458 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ppil1
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Using a gRNA (targeting GTCTGGTCCTGCGTTGGCCA) with CRISPR/Cas9 technology, a single C (G on forward strand) was deleted (NM_026845.4:c.303delC), resulting in a frameshift and premature stop codon.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Ppil1<fs>,
  • Ppil1<fs>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele