| Primary Identifier | MGI:6507762 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Plpp7 |
| Strain of Origin | (C57BL/6 x C3H)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A 559 bp deletion including exon 1 was engineered using sgRNAs (targeting TCCCTGAACCAGCCCCCCAA and GGGTTGGGCCGGCTCCCAGA) with CRISPR/Cas9 technology. RNA sequencing and Western blot analysis confirmed lack of expression from this allele. |