|  Help  |  About  |  Contact Us

Allele : Plpp7<em1Eno> phospholipid phosphatase 7 (inactive); endonuclease-mediated mutation 1, Eric N Olson

Primary Identifier  MGI:6507762 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Plpp7
Strain of Origin  (C57BL/6 x C3H)F1 Is Recombinase  false
Is Wild Type  false
molecularNote  A 559 bp deletion including exon 1 was engineered using sgRNAs (targeting TCCCTGAACCAGCCCCCCAA and GGGTTGGGCCGGCTCCCAGA) with CRISPR/Cas9 technology. RNA sequencing and Western blot analysis confirmed lack of expression from this allele.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Net39 KO,
  • Net39 KO
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele