|  Help  |  About  |  Contact Us

Allele : Mpzl1<em1Ambt> myelin protein zero-like 1; endonuclease-mediated mutation 1, Anton M Bennett

Primary Identifier  MGI:6507873 Allele Type  Endonuclease-mediated
Gene  Mpzl1 Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  Tyrosine codon 242 (TAC) was changed to a phenylalanine codon (TTC) (p.Y242F) through an A-to-T mutation (T-to-A on forward strand) using an sgRNA (targeting TCTAACTGTGCGTAAATGACTGG) and ssODN template with CRISPR/Cas9 technology. Also, two silent mutations were engineered upstream to create an AgeI diagnostic restriction site. The mutation renders the encoded peptide tyrosyl phosphorylation-defective, not only at the targeted Tyr242 but also at Tyr264.
  • mutations:
  • Single point mutation
  • synonyms:
  • Mpzl1<Y242F>,
  • Mpzl1<Y242F>,
  • PZR<Y242F>,
  • PZR<Y242F>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele