| Primary Identifier | MGI:6508540 | Allele Type | Endonuclease-mediated |
| Attribute String | Reporter | Gene | Gt(ROSA)26Sor |
| Strain of Origin | B6.Cg-Gt(ROSA)26Sor<tm9(CAG-tdTomato)Hze>/J | Is Recombinase | false |
| Is Wild Type | false | Project Collection | CPMM |
| description | This allele was generated from Gt(ROSA)26Sortm9(CAG-tdTomato)Hze. |
| molecularNote | CRISPR/Cas9 editing of Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (Ai9) was modified to duplicate a guide target sequences for A.s. and L.b. Cas12a found on the 5' end of the loxP-flanked stop cassette [5'(PAM TTTG) GCAAAGAATTGATTTGATACCGC] onto the 3' end of the stop cassette. With this modification, a single guide RNA for A.s. or L.b. Cas12a can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. CRISPR-modification of Ai9 lead to the partial deletion of the loxP site on the 3' end of the stop cassette. It is believed that the remaining sequence is not sufficient for Cre-mediated recombination with the 5' loxP site. |
