| Primary Identifier | MGI:6508701 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nlrc4 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A 1 bp insertion (or duplication of a T) was created using an sgRNA (targeting CTCTGGAGGCAGGAATCAAT) with CRISPR/Cas9 technology. The resulting frameshift leads to a premature stop codon. Western blot experiments confirmed the lack of peptide expression from this allele. |
