| Primary Identifier | MGI:6508703 | Allele Type | Endonuclease-mediated |
| Gene | Nlrc4 | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Serine codon 533 (TCA) was targeted with an sgRNA (targeting CTCTGGAGGCAGGAATCAAT) and ssODN templates using CRISPR/Cas9 technology, changing it to aspartic acid codon GAT (p.S533D). This mutation creates a phosphomimetic residue at this position. Western blot experiments confirmed the expression of peptides from this allele. |
