|  Help  |  About  |  Contact Us

Allele : Sros1<em1Caox> non-coding RNA suppressor of Stat1; endonuclease-mediated mutation 1, Xuetao Cao

Primary Identifier  MGI:6715665 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Sros1
Strain of Origin  Not Specified Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/Cas9 technology using sgRNAs GAATGATTATTATTGATAGATGG and GTTATTCTCCATGTCGTATGTGG deleted exons 1-3.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Sros1<->,
  • Sros1<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele