|  Help  |  About  |  Contact Us

Allele : Del(8Ddx19a-Ddx19b)1Chaw deletion, Chr 8, Changjiang Weng 1

Primary Identifier  MGI:6693696 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Del(8Ddx19a-Ddx19b)1Chaw
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  The 3' UTR (in exon 12) of Ddx19a and exon 6 of Ddx19b were targeted using two pairs of TALENs (targeting TGGTACGGGTAAAACAGCTG, TGCAGGCTCTACTTGGCTGA, TAGCCCTGGCTTGGTGTGGT, TCTACCCTCCAAGTGCTG), resulting in the deletion of 30,919 bp of sequence including the 5' end of Ddx19a and 3' end of Ddx19b.
  • mutations:
  • Intragenic deletion,
  • Intergenic deletion
  • synonyms:
  • Ddx19-Delta30919,
  • Ddx19-Delta30919
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele