|  Help  |  About  |  Contact Us

Allele : Rab39b<em1Jfch> RAB39B, member RAS oncogene family; endonuclease-mediated mutation 1, Jian-Fu Chen

Primary Identifier  MGI:6695910 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rab39b
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 2 was targeted with two gRNAs (targeting CCTGTAGTAGGCGCGAGTGA and AAGAGGTTATCAAATCAGAG), resulting in a 397 bp deletion. Western blots confirmed the absence of peptide expression in brain.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Rab39b<->,
  • Rab39b<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele