| Primary Identifier | MGI:6753157 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rag2 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Guide RNAs [TGTCTGTGATTTCCTAACGG ; TTCACCTAATCACAAGTAAC] were selected to target intronic DNA flanking exon 3. The allele is a 2,465-nt deletion (GTAGTGTCTGTGATT//del 2,465//AGGTGAATAAAGATGTCAA) that results in the complete loss of exon 3 from the genome. |
