|  Help  |  About  |  Contact Us

Allele : Del(3Sprr2a1-Sprr2a3)1Lvh deletion, chr 3, Lora Hooper

Primary Identifier  MGI:6729717 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Del(3Sprr2a1-Sprr2a3)1Lvh
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  An 81 kb genomic segment encoding Sprr2a1, Sprr2a2, and Sprr2a3 is deleted using CRISPR/Cas9 methodologies (gRNAs: GTGTAGAAAAAAGGATCGGTGGG (upstream), and ATTATCAGCGGTGTACTGCCAGG (downstream); GRCm38.p6: 92,210,732-92,291,813).
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Sprr2a<->,
  • Sprr2a<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

3 Mutation Involves

Trail: Allele

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele