| Primary Identifier | MGI:6753386 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | 4930579G24Rik |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Exon 1 was targeted with two sgRNAs (targeting GTTGGACCGGGACTCCTGCT and CGTGGACCCGCTGGAGCAAG) using CRISPR/Cas9 technology, resulting in a 32 bp deletion (CCCGGTCCAACCGTGGACCCGCTGGAGCAAGT) that causes a frameshift and premature stop codon (p.(Pro44Glyfs*13)). Western blot experiments confirmed the absence of full-length peptides in the testes. |
