| Primary Identifier | MGI:6715230 | Allele Type | Endonuclease-mediated |
| Attribute String | Epitope tag | Gene | Dspp |
| Strain of Origin | (C57BL/6N x SJL)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A single nucleotide was duplicated in the coding region of exon 5 (c.1380dupT) using an sgRNA (targeting TTCGATGACGAGTCCATGCAAGG) and an ssODN template with CRISPR/Cas9 technology. This insertion creates a premature stop codon TAA and prevents translation of most of the sequence coding for the dentin phosphoprotein (DPP) domain. |
