|  Help  |  About  |  Contact Us

Allele : Tsga8<em2Ohbo> testis specific gene A8; endonuclease-mediated mutation 2, Kazuyuki Ohbo

Primary Identifier  MGI:6726554 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tsga8
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 2 was targeted with an sgRNA (targeting CCACGCTTGTTGGTCTTCGCACC) using CRISPR/Cas9 technology, resulting in a 14 bp deletion (TTGTTGGTCTTCGC). Immunohistochemistry and Western blot experiments confirm the absence of peptide expression from this allele in testes.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Tsga8<->#2,
  • Tsga8<->#2
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele