| Primary Identifier | MGI:6727346 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tmem229b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGGTGACTAGAGAGAGCGA and TAGACAATAGGGACGATGGT, which resulted in a 3696 bp deletion beginning at Chromosome 12 position 79,008,403 bp and ending after 79,012,098 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000932830 (exon 3) and 322 bp of flanking intronic sequence including the splice acceptor, start site and donor and is predicted to result in a null allele. |