|  Help  |  About  |  Contact Us

Allele : Zfp622<em1(IMPC)J> zinc finger protein 622; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6731067 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfp622
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGCATTCCCTGGAATCATT and TCCGTCTGACTCCTTTCCAG, which resulted in a 5037 bp deletion beginning at Chromosome 15 position 25,991,444 bp and ending after 25,996,480 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000562948, ENSMUSE00000562947 (exons 4 and 5) and 4780 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 351 and early truncation 3 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Zfp622<->,
  • Zfp622<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele