| Primary Identifier | MGI:6727365 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Opcml |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGTTGGTTGACTAAGGGGA and GAGCTGAGAACTCAACAAAA, which resulted in a 441 bp deletion beginning at Chromosome 9 position 28,813,224 bp and ending after 28,813,664 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000537413 (exon 6) and 320 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 213 and early truncation 1 amino acids later. |
