|  Help  |  About  |  Contact Us

Allele : Cfap47<em1Fzh> cilia and flagella associated protein 47; endonuclease-mediated mutation 1, Feng Zhang

Primary Identifier  MGI:6727102 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cfap47
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 15 was targeted with an sgRNA (targeting CCTGTTTTCGTGGTACAGTTAGG) using CRISPR/Cas9 technology, resulting in the insertion or duplication of a T in the coding sequence (c.2559insT) that causes a frameshift and premature stop codon. RT-qPCR showed reduced transcript expression from this allele in testes and immunohistochemistry experiments showed absence of protein expression.
  • mutations:
  • Insertion
  • synonyms:
  • Cfap47<->,
  • Cfap47<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele