| Primary Identifier | MGI:6727102 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cfap47 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Exon 15 was targeted with an sgRNA (targeting CCTGTTTTCGTGGTACAGTTAGG) using CRISPR/Cas9 technology, resulting in the insertion or duplication of a T in the coding sequence (c.2559insT) that causes a frameshift and premature stop codon. RT-qPCR showed reduced transcript expression from this allele in testes and immunohistochemistry experiments showed absence of protein expression. |
