| Primary Identifier | MGI:6755462 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zbtb9 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAAAGGAGTCGAAGCATCCA and GTAGTCATTTGTAAGTCCAG, which resulted in a 1363 bp deletion beginning at Chromosome 17 position 27,192,601 bp and ending after 27,193,963 bp (GRCm39/mm39). This mutation deletes 1363 bp from ENSMUSE00000716828 (exon 2) coding sequence and is predicted to cause a change of amino acid sequence after residue 1 and termination 16 amino acids later. |
