| Primary Identifier | MGI:6740211 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tmem212 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGTATGTAGAGGGCACAAC and TCGTGACCTAACAGGAGCGG, which resulted in a 2249 bp deletion plus a 1 base pair insertion (T) beginning at Chromosome 3 position 27,938,683 bp and ending after 27,940,931 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000364670, ENSMUSE00000409111 (exons 2 and 3) and 1866 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 53 and early truncation 14 amino acids later. |
