|  Help  |  About  |  Contact Us

Allele : Tnf<em1Boui> tumor necrosis factor; endonuclease-mediated mutation 1, Philippe Bouillet

Primary Identifier  MGI:6728110 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Tnf
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  The adenylate-uridylate-rich element (AU-rich element; ARE) in the 3' UTR was targeted with gRNAs (targeting GTGCAAATATAAATAGAGGG and TGCTTATGAATGTATTTATT) using CRISPR/Cas9 technology, resulting in a 71 bp deletion (TCTATTTATATTTGCACTTATTATTTATTATTTATTTATTATTTATTTATTTGCTTATGAATGTATTTATT).
  • mutations:
  • Intragenic deletion
  • synonyms:
  • TNFdel4,
  • Tnf<del4>,
  • Tnf<del4>,
  • TNFdel4
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele