|  Help  |  About  |  Contact Us

Allele : Ifnar1<em1Kmiy> interferon (alpha and beta) receptor 1; endonuclease-mediated mutation 1, Kensuke Miyake

Primary Identifier  MGI:6763171 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ifnar1
Is Recombinase  false Is Wild Type  false
molecularNote  Exon 1 was targeted with an sgRNA (targeting GCTCGCTGTCGTGGGCGCGG) and tacrRNA using CRISPR/Cas9 technology, resulting in a 757 bp deletion that includes the start codon.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Ifnar1<->,
  • Ifnar1<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele