|  Help  |  About  |  Contact Us

Allele : Banf1<em1(IMPC)J> BAF nuclear assembly factor 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6836771 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Banf1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTAGGAATTGGGACACCCA and TGGAAATTTCCGAATAGCCG, which resulted in a 1621 bp deletion beginning at Chromosome 19 position 5,414,502 bp and ending after 5,416,122 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000145472 and ENSMUSE00000413957 (exons 2 and 3) and 961 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to create a null allele.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Banf1<->,
  • Banf1<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele