|  Help  |  About  |  Contact Us

Allele : Casp8<em1Haka> caspase 8; endonuclease-mediated mutation 1, Hamid Kashkar

Primary Identifier  MGI:6790470 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Casp8
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  Cysteine codon 362 (TGC) was targeted for change to serine (AGC)(p.C362S) with an sgRNA (targeting CACCGTTTCATTCAGGCTTGCCA) and an ssODN template (CACTGGTTCAAAGTGCCCTTCCCTGTCTGGGAAACCCAAGATCTTTTTCATTCAGGCTAGCCAAGGAAGTAACTTCCAGAAAGGAGTGCCTGATGAGGCAGGCTTCGAGCAACAGAAC) using CRISPR/Cas9 technology. The mutation renders the encoded peptide enzymatically inactive.
  • mutations:
  • Single point mutation
  • synonyms:
  • Casp8<C362S>,
  • Casp8<C362S>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele