|  Help  |  About  |  Contact Us

Allele : Dnah10<em2Yxc> dynein, axonemal, heavy chain 10; endonuclease-mediated mutation 2, Yunxia Cao

Primary Identifier  MGI:6780039 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Dnah10
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/cas9 mediated recombination using a single guide RNA (AGATGTGAGGGATGTGCCCAAG) introduced a c.13198G>A in exon 76. The introduced mutation was designed to be homologous to the c.12838G>A identified in a human patient with multiple morphological abnormalities of the sperm flagella (MMAF). Immunostaining indicated reduced levels of expression in testes and spermatozoa from homozygous males.
  • mutations:
  • Single point mutation
  • synonyms:
  • Dnah10<M>,
  • Dnah10<M>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele