| Primary Identifier | MGI:6758791 | Allele Type | Endonuclease-mediated |
| Gene | Il1b | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Lysine codon 133 was targeted with an sgRNA (targeting CATATGGGTCCGACAGCACG) and an ssODN template (CTGCTGGTGTGTGACGTTCCCATTAGACAACTGCACTACAGGCTCCGAGATGAACAACAAAGAAGTCTCGTGCTGTCGGACCCATATGAGCTGAAAGCTCTCCACCTCAATGGACAGAATATCAACCA) using CRISPR/Cas9 technology, resulting in its change to an arginine codon (p.K133R) owing to an A-to-G nucleotide mutation. This change prevents ubiquitylation at amino-acid residue 133. |
