|  Help  |  About  |  Contact Us

Allele : Nelfcd<em1(IMPC)J> negative elongation factor complex member C/D, Th1l; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6860664 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Nelfcd
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGCCTCTAAGTCTATTCAG and TCACTCCTCAGAGTGCAGAG, which resulted in a 318 bp deletion beginning at Chromosome 2 position 174,421,555 bp and ending after 174,421,872 bp (mm10). This mutation deletes ENSMUSE00001272679 (exon 4) and 208 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 105 and early truncation 5 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele