| Primary Identifier | MGI:6860670 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Sae1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCACAAATACCACTCAACTG and CTTCTCTTAGGTGTCAGAAG, which resulted in a 392 bp deletion beginning at Chromosome 7 position 16,368,468 bp and ending after 16,368,859 bp (mm10). This mutation deletes ENSMUSE00000433769 (exon 4) and 249 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 132 and early truncation 16 amino acids later. |
