|  Help  |  About  |  Contact Us

Allele : Celf5<em1(IMPC)J> CUGBP, Elav-like family member 5; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6794034 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Celf5
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGCTTGTGGCAGTAACAC and TGTCCACGAGTGGCAATCAA, which resulted in a 358 bp deletion beginning at Chromosome 10 position 81,305,085 bp and ending after 81,305,442 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001294357 (exon 5) and 278 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 137 and early truncation 13 amino acids later. There is a 2bp insertion (AG) at the deletion site.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele