|  Help  |  About  |  Contact Us

Allele : Atg5<em2Lutzy> autophagy related 5; endonuclease-mediated mutation 2, Cathy Lutz

Primary Identifier  MGI:6864522 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready Gene  Atg5
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/cas9 genome editing used crRNAs to insert loxP sites upstream (TAACTGTGCGGCCACATGAT; GTGTGTACTGACCAATCATG and downstream (GCTGAGCCAGACCTTTGTGC; GCACAAAGGTCTGGCTCAGC) regions of exon 4.
  • mutations:
  • Insertion
  • synonyms:
  • Atg5 cKO,
  • Atg5 cKO
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele