| Primary Identifier | MGI:6849806 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ankrd13b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAAGCACTCCACCAAGCTG and GTACAGCTAGAAAAGAACTA, which resulted in a 1010 bp deletion beginning at Chromosome 11 position 77,366,728 bp and ending after 77,367,737 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000587539, ENSMUSE00001279228 and ENSMUSE00001227155 (exons 5,6,7) and 609 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 140 and early truncation 22 amino acids later. There is a 4 bp insertion AGGA at the deletion site. |
