| Primary Identifier | MGI:6887985 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mageh1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTGTTGTAGGGAATGGGCA and GCCAAAAGCTATGAACCAAT, which resulted in a 1786 bp deletion beginning at Chromosome X position 153,036,011 bp and ending after 153,037,796 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000377789 (exon 1) and 376 bp of flanking intergenic sequence including the start site splice acceptor and donor and is predicted to result in a null allele. In addition, this deletion removes the first exon of long noncoding (LNC)RNA 9530051G07Rik as well as 101 bp of intron 1. |
