|  Help  |  About  |  Contact Us

Allele : Mxd4<em1(IMPC)J> Max dimerization protein 4; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6879485 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Mxd4
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTGAACCAATGCTGCCCAA and GCAAGCCTACAGCAGCGCAG, which resulted in a 274 bp deletion beginning at Chromosome 5 position 34,178,762 bp and ending after 34,179,035 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000242767 (exon 4) and 159 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 65 and early truncation 9 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele