|  Help  |  About  |  Contact Us

Allele : Nek9<em1Nmz> NIMA (never in mitosis gene a)-related expressed kinase 9; endonuclease-mediated mutation 1, Noboru Mizushima

Primary Identifier  MGI:6887930 Allele Type  Endonuclease-mediated
Gene  Nek9 Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  Using an sgRNA (targeting TCGGAGTCCTGGTGCCTCCT) and an ssODN template (TCCTGAGGGCTATGTGGGCTCAGGAGACTAGAGGCTGGGTCGACAAGAGTCTGTTCCGAGGAGGCAGGCGGACTCCGAGTCTAAGTCAGGCTTTGGATCCATTTCCATTTCTTCCTTTGCTGTCTGGGT) with CRISPR/Cas9 technology, tryptophan codon 972 (TGG) in exon 22 was changed to alanine (GCC)(p.W972A). This mutation in the LC3-interacting region (LIR) of the encoded peptide prevents binding to this domain.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • LIR-mutant,
  • Nek9<W967A>,
  • Nek9<W967A>,
  • LIR-mutant
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele