|  Help  |  About  |  Contact Us

Allele : Casp8<em1Gne> caspase 8; endonuclease-mediated mutation 1, Genentech

Primary Identifier  MGI:7259787 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Casp8
Strain of Origin  C57BL/6NTac Is Recombinase  false
Is Wild Type  false
molecularNote  Zygotes carrying the Casp8tm1.1Gne allele (where aspartic acid codon 387 (GAT) in exon 9 was mutated to alanine (GCC) (p.D387A) and the FRT site flanked neomycin selection gene cassette that was inserted into intron 9 was removed through subsequent flp-mediated recombination), were targeted with sgRNAs (targeting GTAAACTTTGTCTGAAGTC) and an ssODN template (CTGAGCACTTGGACATAGCCAGTGTCTGAGCTGCAGCATCAACCCCTGGATTGGGCTTGTGTTTTCCAGACCTCAGCTAAAGTTTACCAAATGAAGAACAAACCTCGGGGATACTGTCTGATCATCAACAATCATGATTTCAGCAAGGCCCGG) template using CRISPR/Cas9 technology to change aspartic acid codon 225 (GAC) in exon 8 to alanine (GCT) (p.D225A). Zygotes carrying these two alleles were then targeted with an sgRNA (targeting CAAGCTAGTGAGTCACGGGT) and an ssODN template (AGTGTGACGTTTTTTTGGTTGCTTGCAGAGATGAGCCTCAAAATGGCGGAACTGTGTGACTCGCCAAGAGAACAAGCTAGTGAGTCACGCGTAGGTGTGTCTCCTACCTCTCTCTTTGCATTGGTGTTCCTGTTTCCTTTGGTTGGTTCCTTT) to change aspartic acid codon 218 (GAC) in exon 8 to alanine (GCT) (p.D218A).
  • mutations:
  • Nucleotide substitutions,
  • Insertion
  • synonyms:
  • Casp8<D218A, D225A, D387A>,
  • Casp8<3xDA>,
  • Casp8<D218A, D225A, D387A>,
  • Casp8<3xDA>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele